Molecular analysis of gibberellin receptor gene GID1 in Dasypyrum villosum and development of DNA marker for its identification

Common wheat (Triticum aestivum 2n = 6x = 42) is one of the world's major crops. According to the FAOCereal production in the world can reach a record level in 2019. Food and Agriculture Organization of the United Nations. Available from: http://www.fao.org/worldfoodsituation/csdb/ru/ [Accessed 17 December 2019], in 2019, world wheat production was estimated at 766 million tons, which was a record high. However, considering the need to provide products for the growing population, wheat productivity should have been increased by 4 to 76% by 2050, according to various forecasts [1]. It is the increase in productivity, and not the expansion of sown areas, that is recognized as the optimal strategy for ensuring food security worldwide. One way to increase productivity is to use wild varieties to transmit valuable agronomic genes to elite crops. Dasypyrum villosum (2n = 2x = 14, VV) is an annual cereal of Triticeae family, it grows in mid-sea region, southwestern Asia and Russia. Species of Dasypyrum genus have approved themselves as a reliable source of resistance genes to biotic [2, 3] and abiotic [4] stress. As a rule, gene transfer from Dasypyrum to common wheat occurs through the use of lines with substituted or translocated chromosomes [5-7]; this method has been widely used from the end of the last century to the present day [8-12].

The influence of short-stem genes on wheat productivity has been shown in a number of studies [13, 14]. Moreover, one of the key factors behind the so-called `green revolution' in agriculture was creation of dwarf wheat varieties using Rht (Reduced height) dwarfing genes [15, 16]. In addition to reducing yield losses due to lodging resistance, dwarfing genes contribute to increased productivity due to better redistribution of assimilates in favor of spike and reduced sprouting due to impaired synthesis of gibberellins or sensitivity to these phytohormones, which play a key role in a wide range of plant growth and development processes, including of fruit and seed formation [17]. Low plant height can be achieved in different ways; however, one of the key factors is a complex interaction of DELLA proteins with other proteins and gibberellins. The Gid1 gene (Gibberellin Insensitive Dwarf 1) encodes a protein that is a receptor for gibberellins. Active forms of gibberellins, joining the GID1 receptor, changes its conformation so that it acquires ability to bind to DELLA proteins. By binding to GID1, DELLA proteins are modified by ubiquitin and destroyed by proteasome, which promotes plant growth. Absence of binding, for any reason, leads to accumulation of DELLA proteins and loss of plant sensitivity to giberrellic acid [17, 18]. Thus, in order to reduce plant growth by altering the components of the gibberellin-GID1-DELLA system, it is necessary to increase stability of DELLA proteins. One of the possible ways to achieve this goal is to influence the Gid1 gene to reduce DELLA binding capabilities, which demonstrates the need for a deeper study of allelic variants of these genes in wheat and its wild varieties.

The aim of our work was sequencing of the Gid1 gene sequences affecting plant height in two Dasypyrum villosum accessions, determining its localization on chromosomes and creating a DNA marker for differentiation of wheat genes and D. villosum genes.

Materials and methods

Results and Discussion

Sequencing of the Dasypyrum villosum Gid1 gene. At first, the mRNA sequence of the wheat Gid1 gene (GenBank FR668558) was used to search for this gene in the IWGSCRefSeqv1.0 wheat genome using BLASTBLAST. Available from: https://wheat-urgi.versailles.inra.fr/Seq-Repository/BLAST [Accessed 17 December 2019]. The greatest homology to this sequence was shown by the wheat genes TraesCS1B02G265900, TraesCS1D02G254500, TraesCS1A02G255100 related to chromosomes 1B, 1D and 1A, respectively. In EnsemblPlants database, these genes are annotated as encoding the GID1 protein. The genomic sequences of these three genes were exported from the assembly of the wheat genome using a genomic browserAvailable from: https://urgi.versailles.inra.fr/jbrowseiwgsc/gmod_jbrowse [Accessed 17 December 2019. The sequence of the rye Gid1 gene was found using BLAST in one of the contigs (FKKI010039294, Lo7_v2_contig_60281) of the Lo7 rye genome related to chromosome 1RAvailable from: https://webblasVol.ipk-gatersleben.de/ryeselect [Accessed 17 December 2019]].

Genome-specific primers and primers for conserved regions of the gene were selected using Primer-BLAST (NCBI)Available from: https://www.ncbi.nlm.nih.gov/tools/primer-blast [Accessed 17 December 2019]. Selected primers are given in Table 2.

These primers were used to amplify the Gid1 gene on DNA of Dasypyrum villosum W6 21717 (accession 1), PI 598390 (accession 2). PCR with primers for common wheat subgenome B and for the rye genome gave positive results.

Table 2 Primers for amplification of Gid1 homolog genes, selected based on wheat and rye sequences

Next, the PCR products were sequenced according NGS method and subjected to bioinformatics processing. As a result, we obtained nucleotide sequences of the two D. villosum accessions of different origin, which were compared with each other, as well as with the nucleotide sequences of wheat from the database (Fig. 1).

As a result of alignment, a high degree of homology between the studied sequences was revealed, however, differences were observed in some regions (mainly single and double nucleotide substitutions), which allowed us to develop a marker able to determine the presence of the Dasypyrum Gid1 gene in a wheat background.

Fig. 1 . A part of alignment of the sequences sequence of the Dasypyrum villosum Gid1 gene

Marker development. The revealed differences between the nucleotide sequences of the D. villosum Gid1 gene and common wheat homolog allowed the development of the pair of primers (DvGid1-1F: AGGTCAACCGCAACGAGTGC and DVGid1-1R: CCAATCCCACCGTCTCGAGCGTA), allowing specific amplification of the Dasypyrum villosum Gid1 gene fragment and not producing a PCR product from wheat DNA (Fig. 2).

Fig. 2. Alignment of the partial sequences of the Gid1 gene for common wheat (chrlA, chrIB chrlD) and D. villosum (DvGidl, obtained in the study). Specific primers for detecting the DvGidl gene are marked in green

Using these primers, a 280 bp region was amplified from the D.villosum DNA samples, while the marker fragment was not amplified from the wheat DNA of various varieties (Fig. 3). This marker can further be used to track the transmission of Dasypyrum genetic material in breeding of common wheat.

Fig. 3. Electrophoresis of the PCR products obtained using primers DvGid1-1F and DvGid1-1R. Wheat cultivars: 1 -- Lebed; 2 -- Pamyat; 3 --Etnos; Dasypirum lines: 4-21717; 5-598390; 6-470279

Mapping of the Gid1 gene on Dasypyrum villosum chromosomes. To map the DvGid1 gene on chromosomes, we used a collection of common wheat lines carrying added, substituted, and translocated D. villosum chromosomes. DNA lines with various additions were used for PCR with the developed marker Dv-Gid-1F/R. As a result, the marker was amplified only in accessions 7677 (1V#3), 3891/89 (1V(1A)), 3896/89 (1V(1D)), 5615 (T1DS^1V#3L), bearing the first chromosome of the Dasypyrum V genome; amplification was absent in the rest of accessions (Fig. 4).

As a result of the study, unique nucleotide sequences of the Gidl gene of two D. villosum accessions of different origin were first obtained. Comparison with homologous genes of common wheat allowed us to develop a genome-specific marker, Dv-Gid-1F/R, which effectively distinguished the DvGidl Dasypyrum gene in a wheat background. Localization of the DvGidl gene on the long arm of chromosome 1V was shown. A preliminary assessment of the phenotypic expression of this gene in a wheat genome background was carried out and a significant effect of the studied gene on plant height was revealed. It was shown that lines carrying a substitution or translocation in the genome were more preferable for such studies, compared with monosomic addition lines.

References / Библиографический список

1.Ray DK, Mueller ND, West PC, Foley JA.Yield trends are insufficient to double global crop production by 2050. PloS one. 2013; 8(6): e66428. doi: 10.1371/joumal.pone.0066428

2.Minelli S, Ceccarelli M, Mariani M, De Pace C, Cionini PG. Cytogenetics of Triticumx Dasypyrum hybrids and derived lines. Cytogenetic and genome research. 2005; 109(1-3):385-392. doi: 10.1159/000082424

3.Li H, Dong Z, Ma C, Tian X, Qi Z, Wu N, et al. Physical Mapping of Stem Rust Resistance Gene Sr52 from Dasypyrum villosum Based on ph1b-Induced Homoeologous Recombination. International Journal of Molecular Sciences. 2019; 20(19):4887. doi: 10.3390/ijms20194887

4.Djanaguiraman M, Prasad PV, Kumari J, Sehgal SK, Friebe B, Djalovic I, et al. Alien chromosome segment from Aegilops speltoides and Dasypyrum villosum increases drought tolerance in wheat via profuse and deep root system. BMC plant biology. 2019; 19(1):242. doi: 10.1186/s12870-019-1833-8

5.Zhang R, Fan Y, Kong L, Wang Z, Wu J, Xing L, et al. Pm62, an adult-plant powdery mildew resistance gene introgressed from Dasypyrum villosum chromosome arm 2VL into wheat. Theoretical and Applied Genetics. 2018; 131(12):2613-2620. doi: 10.1007/s00122-018-3176-5

6.Li G, Gao D, Zhang H, Li J, Wang H, La S, et al. Molecular cytogenetic characterization of Dasypyrum breviaristatum chromosomes in wheat background revealing the genomic divergence between Dasypyrum species. Molecular Cytogenetics. 2016; 9(1):6. doi: 10.1186/s13039-016-0217-0

7.Zhang H, Li G, Li D, Gao D, Zhang J, Yang E, et al. Molecular and cytogenetic characterization of new wheat--Dasypyrum breviaristatum derivatives with post-harvest re-growth habit. Genes. 2015;6(4):1242-1255. doi: 10.3390/genes6041242

8.Blanco A, Simeone R, Resta P. The addition of Dasypyrum villosum (L.) Candargy chromosomes to durum wheat (Triticum durum Desf.). Theoretical and applied genetics. 1987; 74(3):328-333. doi: 10.1007/ BF00274714

9.Friebe B, Cermeno MC, Zeller FJ. C-banding polymorphism and the analysis of nucleolar activity in Dasypyrum villosum (L.) Candargy, its added chromosomes to hexaploid wheat and the amphiploid Triticum dicoccum -- D. villosum. Theoretical and applied genetics. 1987; 73(3):337-342. doi: 10.1007/BF00262498

10.Liu C, Qi L, Liu W, Zhao W, Wilson J, Friebe B, et al. Development of a set of compensating Triticum aestivum-Dasypyrum villosum Robertsonian translocation lines. Genome. 2011; 54(10):836-844. doi: 10.1139/ g11-051

11.Zhang R, Hou F, Feng Y, Zhang W, Zhang M, Chen P., et al. Characterization of a Triticum aestivum -- Dasypyrum villosum T2VS2DL translocation line expressing a longer spike and more kernels traits. Theoretical and applied genetics. 2015; 128(12):2415-2425. doi: 10.1007/s00122-015-2596-8

12.De Pace C, Snidaro D, Ciaffi M, Vittori D, Ciofo A, Cenci A, et al. Introgression of Dasypyrum villosum chromatin into common wheat improves grain protein quality. Euphytica. 2001; 117(1):67-75. doi: 10.1023/A:1004095705460

13.Okuno A, Hirano K, Asano K, Takase W, Masuda R, Morinaka Y, et al. New approach to increasing rice lodging resistance and biomass yield through the use of high gibberellin producing varieties. PLoS One. 2014; 9(2): e86870. doi: 10.1371/journal.pone.0086870

14.Wu Y, Wang Y, Mi XF, Shan JX, Li XM, Xu JL, et al. The QTL GNP1 encodes GA20ox1, which increases grain number and yield by increasing cytokinin activity in rice panicle meristems. PLoS genetics. 2016; 12(10): e1006386. doi: 10.1371/journal.pgen.1006386

15.Hedden P. The genes of the Green Revolution. TRENDS in Genetics. 2003; 19(1):5-9. doi: 10.1016/ S0168-9525(02)00009-4

16.Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, et al. `Green revolution' genes encode mutant gibberellin response modulators. Nature. 1999; 400(6741):256-261. doi: 10.1038/22307

17.Gallego-Giraldo C, Hu J, Urbez C, Gomez MD, Sun TP, et al. Role of the gibberellin receptors GID1 during fruit-set in Arabidopsis. The Plant Journal. 2014; 79(6):1020-1032. doi: 10.1111/tpj.12603

18.Harberd NP, Belfield E, Yasumura Y. The angiosperm gibberellin-GID1-DEELA growth regulatory mechanism: how an “inhibitor of an inhibitor” enables flexible response to fluctuating environments. The Plant Cell. 2009; 21(5):1328-1339. doi: 10.1105/tpc.109.066969

19.Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic acids research. 1980; 8(19):4321-4326. doi: 10.1093/nar/8.19.4321

20.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. Journal of computational biology. 2012; 19(5):455-477. doi: 10.1089/cmb.2012.0021

21.Zaharia M, Bolosky WJ, Curtis K, Fox A, Patterson D, Shenker S, et al. Faster and more accurate sequence alignment with SNAP. 2011. Available from: http://www.icsi.berkeley.edu/pubs/networking/ICSI_ fasterandmoreaccurate11.pdf

22.Nicholas KB, Nicholas HB. Genedoc: a tool for editing and annotating multiple sequence alignments. 1997. Available from: www.nrbsc.org/gfx/genedoc/index.html

23.Zhang R, Sun B, Chen J, Cao A, Xing L, Feng Y, et al. Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene introgressed from Dasypyrum villosum into common wheat. Theoretical and Applied Genetics. 2016; 129(10):1975-1984. doi: 10.1007/s00122-016-2753-8

24.Sokolov PA, Krupin PY, Divashuk MG, Karlov GI. Using PLUG-markers to analyze the collection of soft wheat lines disomically complemented with Dasypyrum villosum chromosomes. Izvestiya of Timiryazev agricultural academy. 2017; (4):147-157. (In Russ). Соколов П.А., Крупин П.Ю., Дивашук М.Г., Карлов Г.И. Использование plug-маркеров для анализа коллекции дисомно дополненных линий мягкой пшеницы хромосомами Dasypyrum villosum // Известия Тимирязевской сельскохозяйственной академии. 2017. № 4. С. 147-157.

Размещено на Allbest.ru