Identification and population variability of local bacillus thuringiensis strains
Identification of local strains of Bacillus thuringiensis. Determination of genotypes and phenotypes using methods of molecular biology and biochemical tests. Variation in strains associated with different types of toxins, as well as genetic variations.
| Рубрика | Биология и естествознание |
| Вид | статья |
| Язык | английский |
| Дата добавления | 22.02.2023 |
| Размер файла | 594,3 K |
Отправить свою хорошую работу в базу знаний просто. Используйте форму, расположенную ниже
Студенты, аспиранты, молодые ученые, использующие базу знаний в своей учебе и работе, будут вам очень благодарны.
Размещено на http://www.Allbest.Ru/
Identification and population variability of local bacillus thuringiensis strains
Khalilov I.M., Qobilov F.B.,
Azimova N.Sh., Nazirov M.M.,
Mardonov I.H., Akhmedova N.S.,
Turaeva S.Sh.
Abstract
This research involved the use of Bacillus thuringiensis (Bt) strains Btl, Btl8fo, Bt26, Bt31, Bt84, Bt91, Bt93 and Bt94 that were isolated from different regions of Uzbekistan. To identify the eight isolated Bt entomopathogenic strains, the 16S rRNA gene 16S-23S internal transcribed spacer (ITS) region nucleotide sequences were partially sequenced, and a phylogenetic tree was constructed. It was found that there were differences partial nucleotides in the 16S rRNA gene of eight Bt strains. However, they are 99.51-100% similar to bacteria belonging to the Bacillus cereus group. When the Bt strains were aligned with each other in the Clustal Omega online program, differences in the 16S rRNA gene were noted even though they were isolated from the same ecological zone. In addition, PCR analysis of cry1Aa, cry1Ab, cry2B, cry9Ba-I and cry1Ac genes showed the presence of cry1Ab and cry9Ba-I genes in strains Bt1, Bt18fo, Bt26, Bt31, Bt91, Bt93 and Bt94. The cry2B gene was detected only in the Bt31 strain, while the cry1Ac gene was detected in the Bt1 and Bt84 strains.
Keywords: Bacillus thuringiensis, entomopathogen, 16S rRNA gene, taxonomy, identification.
Аннотация
Идентификация и популяционная изменчивость местных штаммов bacillus thuringiensis
Халилов И.М., Кобилов Ф.Б., Азимова Н.Ш., Назиров М.М., Мардонов И.Х., Ахмедова Н.С., Тураева С.Ш.
В данном исследовании использовались штаммы Bacillus thuringiensis (Bt) Bt1, Bt18fo, Bt26, Bt31, Bt84, Bt91, Bt93 и Bt94, выделенные из разных регионов Узбекистана. Для идентификации восьми выделенных энтомопатогенных штаммов Bt были частично секвенированы нуклеотидные последовательности области 16S-23S (ITS) гена 16S рРНК 16S и построено филогенетическое дерево. Было обнаружено, что в гене 16S рРНК восьми штаммов Bt имеются различия частичных нуклеотидов. Однако они на 99,51-100% сходны с бактериями, относящимися к группе Bacillus cereus. Когда штаммы Bt были сопоставлены друг с другом в онлайн-программе Clustal Omega, были отмечены различия в гене 16S рРНК, даже если они были изолированы из одной экологической зоны. Кроме того, ПЦР-анализ генов crylAa, crylAb, cry2B, cry9Ba-I и crylAc показал наличие генов crylAb и cry9Ba-Iу штаммов Btl, Bt18fo, Bt26, Bt31, Bt91, Bt93 и Bt94. Ген cry2B обнаружен только у штамма Bt31, тогда как ген crylAc обнаружен у штаммов Btl и Bt84.
Ключевые слова: bacillus thuringiensis, энтомопатоген, ген l6S рРНК, таксономия, идентификация.
Introduction
Bacillus thuringiensis (Bt) is a gram-positive, spore-forming, rod-shaped soil bacterium that is found in various ecological systems throughout the earth, including in soil, water, dead insects, the leaves of deciduous trees, the internal tissues of some plants (endophytes) and milk. [1-4]. Bt bacteria produce broad-spectrum insecticidal proteins that are active against the larvae of a wide variety of insects and have sometimes been observed to affect insects other than these as well. The products made on the basis of these bacteria have become the most frequently sold biological insecticides worldwide [4,5], as they include genes that encode proteins with insecticidal properties and introduce the possibility of creating new types of transgenic plants that are resistant to pests as a result of their transfer to plants [6]. Based on phenotypic and genotypic analyses, Bt species belong to the Bacilus cereus group of bacteria. However, the identification of vegetative and spore forming Bt bacterial strains with B. cereus species through morphological [7], phenotypic [8] or genotypic methods is very difficult [9]. Bt strains can be identified mainly by the synthesis of cry (cyt or vip)-proteins in crystal form [10]. Comparisons of the Bt strains belonging to the B. cereus group according to 16S rRNA and gyrB gene nucleotide sequences based on arbitrarily primed (AP)-PCR, including box element (BOX) and enterobacterial repetitive intergenic consensus (ERIC), and saAFLP methods showed that Bt strains were divided into separate groups. Indeed, these methods have been found to be suitable for detecting differences in Bt bacteria within species.
Differentiation of Bt bacteria within species was also reported using repetitive element (REP) - PCR and ERIC-PCR, but no correlation was observed between the isolation sites and insect toxicity.
Since Lepidoptera, Diptera, Coleoptera, Hemiptera, Hymenoptera and similar pests cause great damage to a number of plants worldwide, introducing genes that encode insecticidal proteins into plants is a very effective way to protect plants from these pests [13, 14, 15]. Because of the presence of Bt isolates with unique proteins of insecticidal genes in every ecological system, research groups around the world are constantly studying different biological samples to find such new Bt isolates [16, 17, 18].
The purpose of this research work is to identify the 16S and 23S (ITS) region of the rRNA partial gene of the Btl, Btl8fo, Bt26, Bt3l, Bt84, Bt9l, Bt93 and Bt94 strains that was isolated from different areas of Uzbekistan through molecular genetic methods. It is also necessary to identify some cry genes of these strains and to determine the difference between these strains and the B. cereus and other Bacillus species.
Materials and methods
Strains of Bacteria and Medium. The Btl, Btl8fo, Bt26, Bt3l, Bt84, Bt9l, Bt93 and Bt94 strains were examined as the object of the study. The Btl, Btl8fo, Bt26 and Bt3l strains were isolated from the fields of honey waxwormbreeding enterprises around Kibrai, in the Tashkent region. The Btl strain was isolated from the insect Helicoverpa armigera, and the remaining strains, Btl8fo, Bt26 and Bt3l, were isolated from the dead insect Galleria mellonella. The Bt84, Bt9l, Bt93 and Bt94 strains were isolated from Lymantria dispar in the forest zone of Ugam-Chotkal National Park in the Tashkent region.
Bacteria were grown in a peptone nutrient medium (PB): Peptone-1.0%, glucose-0.6%, NaCl-0.5%, K2HP04-0.05 % and MgSO4-0.02% (pH-7.0).
DNA isolation and PCR amplification of the 16S rRNA gene of B. thuringiensis strains DNA extraction of eight Bt isolates was performed according to the Wizard Genomic DNA Purification Kit [19]. Extracted DNA samples were stored at -20°C. The following primers were used in the PCR reactions: forward 5'-TCTCAGTCGGATTGTAGGC-3' and reverse 5'- ATCGACTCCTAGTGTCAAGG-3' [20]. Amplification reactions were conducted in a Mastercycler thermal cycler (Bio-rad, USA). The PCR products were then detected on a 1.5% agarose-EtBr gel, and the amplified PCR products were observed in a GelDoc system (Bio-rad, USA). PCR amplification was carried out as described previously [20].
Table 1
PCR-amplification of cry genes of Bt strains was carried out using the following primers.
|
Gen name |
Sequence (5' ^3') |
bp |
Reference |
|
|
cry1Aa-I (F) |
TGCATAGAGGC TTTAAT |
1500 |
[20] |
|
|
cry1Aa-cI (R) |
CAGGATTCCATTCAAGG |
|||
|
cry1Ab-I (F) |
TCGGAAAATGTGCCCAT |
858 |
||
|
cry1Ab-I (R) |
AATTGCTTTCATAGGCT |
|||
|
cry9Ba-I (F) |
CGGTGTTACTATTAGCGAGGGCGG |
351 |
[21] |
|
|
cry9Ba-I (R) |
GTTTGAGCCGCTTCACAGCAATCC |
|||
|
cry2-I (F) |
GGATCCATATGAATAGTGTATTGAAT |
1926 |
||
|
cry2-I (R) |
GGATCCATATGAATAGTGTATTGAAT |
The PCR products were then electrophoresed on a 1.5% agarose-ethidium bromode (EtBr) gel and the amplified PCR products were detected in a GelDoc system (Bio-rad, USA). Sequencing was carried out using the BigDye Terminator v.3.1 cycle sequencing kit and Applied Biosystems® Genetic Analyzers, 3130 series sequencers (Thermo Fischer Scientific, USA).
Results
In recent years, a large number of databases have been developed for 16S rRNA, and based on these the phylogenetic position of bacteria is being identified. Because most 16S rRNA genes make up about 1,500 base pairs, some branches of the genes as domains (Archaea, Eucaea and Bacteria) reveal broad characteristics of phylogenetic groups, while other branches of the gene reveal narrower characteristics of groups, such as phylum, class and genus. A 16S rRNA gene sequence similarity of 97% provides information about the genus of the bacteria, while a similarity above 99% provides information about the species [22].
PCR products of eight B.thuringiensis strains. To identify the 16S and 23S (ITS) region of the rRNA partial gene of the Bt bacterial strains, genomic DNA was isolated and a PCR product over 400 bp was obtained using primers (Figure 1).
To compare the phylogenetic position of Bt bacterial strains to each other and to other species of bacteria, the 16S-23S (ITS) part of the rRNA gene was sequenced, and a 410 bp nucleotide sequence was determined. The results of the nucleotide sequences of the 16S rRNA gene 16S-23S (ITS) that were obtained were placed in the National Center for Biotechnology Information (NCBI) database, and the following accession numbers were obtained: Bt1 (MN244691), Bt18fo (MN244692), Bt26 (MN244693), Bt31 (MN244694), Bt84 (MN244695), Bt91 (MN244696), Bt93 (MN244697) and Bt94 (MN244698).
Fig. 1. The 1kb marker. 1-Bt1, 2-Bt18fo, 3-Bt26, 4-Bt31, 5-Bt84, 6-Bt91, 7-Bt93 and 8-Bt94 and the PCR product of 16S-23S (ITS) part of rRNA gene.
Multiple sequence alignment of eight B.thuringiensis strains. The 16S rRNA gene that was isolated from the Bt strains studied experimentally was aligned in the Clustal Omega online software program for comparison based on the partial sequence of the strains (Figure 2).
However, the nucleotide sequences of the Bt31 strain 23 - (C/T) and 32 - (T/C) underwent transversion mutations and differed from the nucleotide sequences of other strains. Also, the Bt94 strain, unlike other strains, underwent an inversion mutation at the 284th position, creating a new nucleotide (-/A). In strain Bt91, a transversion mutation was detected at nucleotide positions 382 - (T/A), 384 - (A/T) and 389 - (T/A), while a transition mutation was noted at nucleotide position 390 - (A/G). It was also found that the Bt91 strain, unlike other strains, had a deletion at position 390 (G/-), and in the Bt1 strain the nucleotides at position 330 - (T/A) were changed by transversion. No single nucleotide polymorphisms (SNPs) were observed in the nucleotide sequences of strains Bt18fo, Bt26, Bt84 and Bt93.
Phylogenetic Tree
Based on the nucleotides that were identified, it was noted that the Bt strains differed from one another by one or five nucleotides. Based on the nucleotide sequences of the 16S rRNA gene that were obtained, a phylogenetic tree was constructed using the maximum likelihood statistical method with the Mega 4 bioinformatics program (Figure 3).
Fig. 2. Intercomparisons of partially sequenced 16S rRNA gene nucleotide sequences of Bt strains
variability genotype phenotype strain вacillus thuringiensis
Fig. 3. The phylogenetic tree of the local Bt strains using the Mega 4 bioinformatics software maximum likelihood statistical method
All strains were found to be 99.8% identical to B. thuringiensis and B. cereus when checked against the NCBI database. Also, the Bt1, Bt26, Bt84, Bt93 and Bt94 strains showed 99.78% similarity to B. cereus bacteria, the Bt18fo and Bt91 strains showed 99.77-100% similarity to B. cereus bacteria and the Bt31 strain showed 99.51% similarity to B. cereus bacteria. As seen in Figure 3, the nucleotide sequences of all sequenced strains are very similar, amounting to 99.9%.
The phylogenetic tree showed that the Bt18 strain was observed to form a new clade that was separate from other strains. Bt strains were found to be 99% identical to strains of B. cereus, B.tropicus, B.subtilis, B.albus and B.mobilus. It was noted that Pseudomonas putida and Escherichia coli bacteria, which are considered to be out of the Bacillus group, branch separately in the phylogenetic tree.
Since some local strains of Bt bacteria have differences in the nucleotide sequences of the 16S rRNA gene, the presence of cry1Aa, cry1Ab, cry2B, cry9Ba-I and cry1Aс genes was analysed using PCR to determine the differences in the content of the cry toxins produced by these strains.
Table 2
PCR products of cry genes of Bt bacteria (- cry gene is not present; + cry gene is present)
|
№ |
Used strains |
PCR amplified cry genes |
|||||
|
crylAa-I |
crylAb |
cry9Ba-I |
cry2 |
CrylAc-I |
|||
|
1 |
Bt 1 |
- |
+ |
+ |
- |
+ |
|
|
2 |
Bt 18$o |
- |
+ |
+ |
- |
- |
|
|
3 |
Bt 26 |
+ |
+ |
+ |
- |
- |
|
|
4 |
Bt 31 |
- |
+ |
- |
+ |
- |
|
|
5 |
Bt 84 |
- |
- |
+ |
- |
+ |
|
|
6 |
Bt 91 |
- |
+ |
+ |
- |
- |
|
|
7 |
Bt 93 |
- |
+ |
+ |
- |
- |
|
|
8 |
Bt 94 |
- |
+ |
+ |
- |
- |
Table 2 shows that in the PCR analysis of cry1Aa, cry1Ab, cry2B, cry9Ba-l and cry1Ac genes, the cry1Aa gene was found only in the Bt26 strain, although the presence of cry1Ab and cry9Ba-l was observed in the Bt1, Bt18fo, Bt26, Bt31, Bt91, Bt93 and Bt94 strains. While cry2B and cry1Ab genes were found in the Bt31 strain, the cry1Ac gene was detected in the Bt1 and Bt84 strains. It should be noted that three cry genes were found in Bt1 (cry1Ab, cry9Ba-Iand cry1Ac) and Bt26 (cry1Aa, cry1Ab and cry9Ba-I) strains used in the experiment.
Discussion
Gypsy moth larvae can damage more than 300 species of trees for 10 weeks a year [24]. During such outbreaks, high densities of caterpillars can be a nuisance and a health concern to homeowners, especially those who live in or adjacent to forested areas [25]. To control these insects in natural forest areas, it is important to use biological insecticides instead of chemical pesticides to avoid destroying the ecological systems. One method of biological control in forest zones is through the use of preparations made with B.thuringiensis bacteria. Therefore, genetic identification of these bacterial species is important along with studying cry genes that express insecticidal activity. However, difficulty with regard to genetic identification of bacteria that belong to the B. cereus group is causing some controversy.
Liu et al. found that determining the sequence of the 16S rRNA gene did not provide sufficient information to be able to differentiate the bacteria belonging to the B. cereus group, because these bacteria are highly conservative. The authors also noted that the presence or absence of cry genes in B.thuringiensis bacteria cannot be a phenotypic characteristic that differences them from other bacteria of the Bacillus group. However, according to the debate about the difference in the species of the bacteria B.anthracis, B.cereus and B.thuringiensis, can be achieved using the analysis of the whole genome sequence. They have shown that the housekeeping genes pycA and ccpA are suggested to identify rapidly of this group isolates [26].
Indeed, the data we obtained showed that the 16S rDNA gene sequences were not genetically distinct from bacteria of the B. cereus group in the phylogenetic tree. The 16S rRNA gene nucleotide sequences of native Bt strains were found to be 99% similar to other Bt strains that were investigated. However, these local strains are very similar to other strains of the Bacillus group, and it is difficult to separate them into different species from a molecular-genetic point of view.
We identified these strains as being of the B.thuringiensis species only by having of bipyramidal and also the presence of cry-genes. In future, we plan to conduct a study to compare the number of 16S rDNA gene repeats, using pycA and ccpA genes by whole-genome sequencing.
Modern studies show that the population variability of bacteria is related to the processes of internal genome recombination in the genetic material of the cell [27]. It is known that the population of microorganisms is heterogeneous and is characterized by the presence within the population (of one strain) of cells that differ with regard to a number of colonial-morphological and physiological-biochemical properties and are capable of dissociative transitions with high frequencies (10-2-10-4 per cell division) [28].
We can observe in our study that such variability has changed the genetic characteristics of the bacterium B.thuringiensis in one population environment. In the studies conducted by G. Vilas- Boas et al., five strains of B.thuringiensis that were isolated from different population environments (F and S sites) were distinguished by their electrophoretic types (ETs) and numbers of alleles at the gene locus [29]. The authors identified isolates from different ecological zones of Brazil and found that these were genetically differentiated according to random amplified polymorphic DNA (RAPD) PCR results. They also found that the plasmid DNA profile of the two isolates from the granary was different [30].
Conclusion
The results of our research show that although strains Bt1, Bt18fo, Bt26 and Bt31 were isolated from one population zone around Kibrai, in the Tashkent region, they showed genetic differences. This may be because of the rapid genetic changes that occur in Bt strains within a population zone that is under the influence of external factors or as a result of changes in the host organisms. Some of these eight Bt strains were found to contain specific cry genes. The strains were differentiated because Bt84 strain had cry9Ba-I and cry1Ac genes, while the Bt91 strain had cry1Ab and cry9Ba-I genes. Both Bt93 and Bt94 strains were found to have the same cry1Ab and cry9Ba-I. Therefore, the wide distribution of B.thuringiensis bacteria throughout the world and the fact that these bacteria live in different ecological environments and are influenced by biotic and abiotic factors can lead to a high level of genetic variability.
References / Список литературы
1. Hцfte H.; Whiteley H.R. Insecticidal Crystal Proteins of Bacillus thuringiensis // Microbiol. Rev. 1989. 53. P. 242-255.
2. Knowles B.H, Dow J.A.T. The crystal delta-endotoxins of Bacillus thuringiensis Models for their mechanism of action on the insect gut // Bioessays 1993, 15, P. 469-476.
3. Raymond B., Johnston, P.R.; Nielsen-LeRoux C., Lereclus D., Crickmore N. Bacillus thuringiensis'. An impotent pathogen // Trends Microbiol. 2010. 18. P. 189-194.
4. Roh J.Y.; Choi J.Y.; Li M.S.; Jin B.R.; Je Y.H. Bacillus thuringiensis as a specific, safe, and effective tool for insect pest control // J. Mol. Biol. 2007, 17, P. 547-559.
5. Schnepf, E.; Crickmore, N.; van Rie, J.; Lereclus, D.; Baum, J.; Feitelson, J.; Zeigler, D.R.; Dean, D.H. Bacillus thuringiensis and its pesticidal crystal proteins // Microbiol. Mol. Biol. Rev. 1998, 62, 775-806.
6. Sanchis К From microbial sprays to insect-resistant transgenic plants:History of the biospesticide Bacillus thuringiensis. A review // Agron. Sustain. Dev. 2011, 31, P. 217-231.
7. Baumann L., Okamoto, K., Unterman, B.M., Lynch, M.J. &Baumann, P.1984. Phenotypic characterization of Bacillus thuringiensis (Berliner) and B. cereus (Frankland & Frankland) // J. Invertebr. Pathol. 44, P. 329-341.
8. Aronson A.I. // Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics eds // Sonenshein A.B., Hoch J.A., Losick r. Washington, D.c.: Amer. Soc. Microbiol., 1993. P. 953-963.
9. Talaat A. El-kersh, Ashraf M. Ahmed, Yazeed A. Al-sheikh, Frйdйric Tripet, Mohamed S. Ibrahim, Ali A.M. Metwalli Isolation and characterization of native Bacillus thuringiensis strains from Saudi Arabia with enhanced larvicidal toxicity against the mosquito vector Anopheles gambiae (s.l.) // J. Parasites & Vectors (2016) 9:647.
10. N. Crickmore, D.R. Zeigler, J. Feitelson, E. Schnepf, J. van Rie, D. Lerecus, J. Baum and D.H. Dean, “Revision of the Nomenclature for the Bacillus thuringiensis Pesticidal Crystal Proteins // Microbiology and Molecular Biology Reviews, Vol. 62, No. 3, 1998, P. 807-813.
11. Punina N.V., Zotov V.S., Parkhomenko A.L., Parkhomenko T.U., Topunov A.F. Genetic Diversity of Bacillus thuringiensis from Different Geo-Ecological Regions of Ukraine by Analyzing the 16S rRNA and gyrB Genes and by AP-PCR and saAFLP// Acta Naturae, 2013. Vol. 5 №1 (16). P. 90-100.
12. Machado D.H.B., Livramento K.G., Maximo W.P.F., Negri B.F., Paiva L.V., Valicente F.H. Molecular characterization of Bacillus thuringiensis strains to control Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) population // Revista Brasileira de Entomologia e201947, 2020. 64 (1). P. 1-6.
13. Vaeck M., Reynaerts A., Hofte H., Jansens S., De Buckeleer M., Dean L., Zabeau M., Van Montagu M., Leemans J. (1987). Transgenic plants protected from insect attack // Nature, 328: P. 33-37.
14. Perlak F.J., Deaton R.W., Armstrong T.A., Fuchs R.L., Sims S.R., Greenplate J.T., Fischhoff D.A. (1990). Insect resistant cotton plants // Bio.Tech. 8: P. 939-943.
15. Lin Y., Fang G., Peng K. (2007). Characterization of the highly variable cry gene regions of Bacillus thuringiensis strain ly4a3 by PCR-SSCP profiling and sequencing // Biotechnol Lett. 29: P. 247-251.
16. Campanini, E.B., Davolos, C.C., Alves, E.C., da, C., and Lemos, M.V.F. (2012). Caracterizagao de novos isolados de Bacillus thuringiensis para o controle de importantes insetos-praga da agricultura // Bragantia 71,362-369.
17. Soares-da-Silva J., Pinheiro V.C.S., Litaiff-Abreu E., Polanczyk R.A., and Tadei, W.P. (2015). Isolation of Bacillus thuringiensis from the state of Amazonas, in Brazil, and screening against Aedes aegypti (Diptera,Culicidae)// Rev. Bras. Entomol. 59,1-6.
18. El-Kersh, T.A., Ahmed, A.M., Al-Sheikh, Y.A., Tripet, F., Ibrahim, M.S., and Metwalli, A.A. M. (2016). Isolation and characterization of native Bacillus thuringiensis strains from Saudi Arabia with enhanced larvicidal toxicity against the mosquito vector Anopheles gambiae (s.l.) // Parasit. Vectors 9:647
19. Promega. Wizard® Genomic DNA Purification Kit
20. Versalovic J., M. Schneider, F.J. de Bruijn, and J.R. Lupski. 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction // Meth. Mol. Cell Biol. 5:P. 25-40.
21. Bourque S.N., J.R. Valero, J. Mercier, M.C. Lavoie, and R.C. Levesque. 1993. Multiplex polymerase chain reaction for detection and differentialtion of the microbial insecticide Bacillus thuringiensis // Appl. Environ. Microbiol. 59:P. 523-527.
22. Eitan Ben-Dov, Qingfeng Wang, Arieh Zaritsky, Robert Manasherob, Ze'ev Barak, Bert Schneider, Aloviddin Khamraev, Mukhtar Baizhanov, Victor Glupov, and Yoel Margalith. Multiplex PCR Screening to Detect cry9 Genes in Bacillus thuringiensis Strains // Applied and Environmental Microbiology
23. Reddy D.M., Paul D., Reddy H.K., Reddy G. Characterization and identification of Bacillus cereus GMHS: An efficient 2-picoline degrading bacteria // Int. J. Integrative Biol., 2009. 3: P. 187-191.
24. Elkinton J.S., & LiebholdA.M. Population dynamics of gypsy moth in North America // Annual Reviewof Entomology,1990.35(1), P.571-596.
25. Coleman T.W., Haavik L.J., Foelker C., Liebhold A.M. Gypsy Moth// Forest Insect & Disease Leaflet 162. April 2020. P.1-20.
26. Yang Liu, Qiliang Lai, Markus Goker, Jan P. Meier-Kolthoff, Meng Wang, Yamin Sun, Lei Wang and Zongze Shao. Genomic insights into the taxonomic status of the Bacillus cereus group // Sci Rep 5, 14082 (2015).
27. Prozorov A.A. Recombinant restructuring of the bacteria genome, and adaptation to the habitat // Microbiology. 2001. T. 70, № 5. P.581-594.
28. Milko E.S. Egorov N.S. Heterogenicity of the bacterial population and the dissociation process. // Publishing House of Moscow State University.1991. P. 143.
29. Vilas-Boas G., Sanchis V., Lereclus D., M. Victor F., Lemos, Bourguet D. Genetic Differentiation between Sympatric Populations of Bacillus cereus and Bacillus thuringiensis // Applied and Environmental Microbiology, 2002, Mar. P. 1414-1424.
30. G.T. Vilas-BoasFranco Lemos M.V. Diversity of cry genes and genetic characterization of Bacillus thuringiensis isolated from Brazil//Can. J. Microbiol. 2004. 50. P. 605. 613
Размещено на allbest.ru
...Подобные документы
Общие бактериальные болезни насекомых, энтомопатогенные бактерии. Негативное влияние бактерий на здоровье человека. Характеристика и механизм действия бактерий Bacillus thuringiensis. Бактериальные препараты: применение и методы повышения эффективности.
курсовая работа [48,4 K], добавлен 02.12.2010История и классификация антибиотиков. Их влияние на бактерии рода Bacillus. Интенсивность роста колоний данного микроорганизма при различных концентрациях антибиотика, растворённого в питательной среде. Метод диффузии в агар с использованием желобка.
курсовая работа [1,8 M], добавлен 09.09.2009It was proposed to use the 2H-labeled hydrolysate of RuMP facultative methylotroph Brevibacterium methylicum, obtained from deuterated salt medium dM9 as a substrate for the growth of inosine producing bacterium Bacillus subtilis.
статья [550,4 K], добавлен 23.10.2006Аэробные спорообразующие бактерии (бациллы), род Bacillus семейства Bacillaceae, их морфолого-физиологические признаки. Санитарно-показательные микроорганизмы. Санитарно-гигиеническая характеристика пищевых продуктов. Возбудители кишечных заболеваний.
контрольная работа [20,4 K], добавлен 10.06.2009The role of deuterium in molecular evolution is most interesting question of nowdays science comprises two points mainly: the evolution of deuterium itself as well as the chemical processes going with participation of deuterium.
статья [426,3 K], добавлен 23.10.2006Types of microorganisms. Viruses consist of genetic materials. Bacteria are organisms made up of just one cell. Algae are a type of living thing. Fungi are like plants that are not "green", they do not have the photosynthetic pigment chlorophyll.
презентация [188,3 K], добавлен 16.03.2014Механизм воздействия прокариотических микроорганизмов на спав и липазу. Щелочные протеиназы рода Bacillus. Методика выделения, изучение свойств концентрированного ферментного препарата и порядок его применения в процессе обезжиривания меховой овчины.
дипломная работа [169,7 K], добавлен 27.11.2010Осуществлен биосинтез 2Н-меченого пуринового рибонуклеозида инозина с использованием адаптированного к дейтерию штамма Bacillus subtilis в тяжеловодородной среде высокого уровня дейтерированности с гидролизатом биомассы метилотрофной бактерии.
статья [2,5 M], добавлен 23.10.2006Vectors of the molecular cloning, their functions and basic properties. Double-stranded phage. Scope of Present Review. Life cycle and genetics of Lambda. Phage Lambda as a vector. Transfection of Recombinant Molecules. Storage of Lambda Stocks.
курсовая работа [1,4 M], добавлен 11.12.2010The account of all the system of modern evolutionary biology is a compositive evolution theory, the principal case of which have been established by the works of Chetverikov, Fisher, Holdane, Dubinin and etc.
реферат [5,4 K], добавлен 25.12.2004Charles Darwin, Darwin’s Critters. The Journey Home. The Ride Home. Ideas that Shaped Darwin’s Thinking. Darwin Presents His Case. Publication of On the Origin of Species by Means of Natural Selection. Inherited Variation & Artificial Selection.
презентация [6,8 M], добавлен 18.10.2013The biosynthesis of 2H-labeled phenylalanine was done by converse of low molecular weight substrates in a new RuMP facultative methylotrophic mutant Brevibacterium methylicum. Isotope components of growth media and characteristics of bacterial growth.
статья [1,3 M], добавлен 23.10.2006Foot distal extremity man is a set, which is in contact with the ground and serves as a support when moving. The main function of the foot of man. Basic types of muscles of the foot. The rear, medial, lateral and middle groups of muscles of the foot.
презентация [3,1 M], добавлен 14.04.2015The overall architecture of radio frequency identification systems. The working principle of RFID: the reader sends out radio waves of specific frequency energy to the electronic tags, tag receives the radio waves. Benefits of contactless identification.
курсовая работа [179,1 K], добавлен 05.10.2014Віруси у захисті рослин. Використання бакуловірусів для захисту рослин. Бактерії, що спричинюють хвороби комах, та препарати для захисту рослин. Препарати на основі Bacillus thuringiensis. Безпечність мікробіологічних препаратів захисту рослин.
контрольная работа [633,4 K], добавлен 25.10.2013Пищевые токсикологические инфекции - болезни человека, связанные с приёмом пищи, обильно обсеменённой определенными видами бактерий. Этиологическая роль Bacillus cereus при пищевых отравлениях. Морфологические, культуральные и ферментативные свойства.
курсовая работа [39,7 K], добавлен 18.12.2010The first modern socialists. What Marx did. The myth of anarchist "Libertarianism". Lassalle and state socialism. The Fabian model. Six strains of socialism-from-above: phіlаnthropіsm, elіtіsm, plаnnіsm, "communіsm", pеrmеаtіonіsm, socіаlіsm-from-outsіdе.
реферат [54,1 K], добавлен 21.06.2010Study of the problems of local government in Ukraine. Analysis of its budgetary support, personnel policy, administrative-territorial structure. The priority of reform of local self-management. The constitution of Palestine: "the state in development".
реферат [15,9 K], добавлен 10.02.2015Consideration of a systematic approach to the identification of the organization's processes for improving management efficiency. Approaches to the identification of business processes. Architecture of an Integrated Information Systems methodology.
реферат [195,5 K], добавлен 12.02.2016Positive proposals needed, objections to centralisation, embrace New Zealand. Renaming the states, democratic considerations. Land management, planning, financial and geographical considerations. Local government in provincial cities and the country.
эссе [66,2 K], добавлен 24.06.2010
